Illustration Design Project
Una empresa en United States necesitaba un illustration design y recibió 5 Elegante, Juguetón, Electronic illustration designs de 3 diseñadores
Diseños
Diseñadores
Presupuesto
1 - 5 de 5 diseños de ilustración propuestas
Esto es lo que buscaba un negocio en United States en su illustration design
I would like to have either a hand-drawn or electronic illustration somewhat analogous to the attached illustration of an old iGeekify website. Basically, I want an element like the one that appears to be hand drawn by them, and I plan on embedding it into a website with the text and button elements. The site is a synthetic biology website, so it needs biological overtones to it. I just need the illustration, not an entire web page. The overall size and colors should be analogous to what is in this image. The specific content doesn't have to mean much, but it needs to be turned into DNA letters somehow. One way I've thought to do this would be to put random strings of A,T,C, and G (like ATTACACAAGACGGATACCGG) as a brush stroke in place of the lines in the water, as if the "ship" is floating on a see of DNA sequence. A ship is still fine, a rocket would be nice, a factory would be really appropriate. I'm very open to creative solutions to this. The only real requirements are t… Leer más